Review



caggtgatactatcaaccaaa merck cat  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Merck & Co caggtgatactatcaaccaaa merck cat
    Caggtgatactatcaaccaaa Merck Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caggtgatactatcaaccaaa+merck+cat/caggtgatactatcaaccaaa+cat+merck+trcn000107267/pm39524367-229-85-86
    Average 86 stars, based on 1 article reviews
    caggtgatactatcaaccaaa merck cat - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Intra-tumoral YAP and TAZ heterogeneity drives collective NSCLC invasion that is targeted by SUMOylation inhibitor TAK-981.
    Article Snippet: Extraction Reagents Thermo Scientific Cat#78833 .. Experimental models: Cell lines Human:H1299-leader cells Commander et al.20 N/A Human:H1299-follower cells Commander et al.20 N/A Human:H1299 Commander et al.20 N/A Human:H460 Adam Marcus, Emory University N/A Human:H23 Adam Marcus, Emory University N/A Human:H1975 Adam Marcus, Emory University N/A Human:H596 Adam Marcus, Emory University N/A Human:PC9 Sun et al.78 N/A Human:A549 ATCC Cat#CCL-185 Human:H293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains NOD scid gamma NSG Jackson Laboratory Cat#006667 Oligonucleotides shRNA targeting sequence TAZ#1; TAAGCTTTATGGGTGTTAATT Merck Cat#TRCN000370006 shRNA targeting sequence TAZ#2; CAGCCAAATCTCGTGATGAAT Merck Cat#TRCN000319150 shRNA targeting sequence YAP#1; CAGGTGATACTATCAACCAAA Merck CatTRCN000107267 shRNA targeting sequence YAP#2; CAGGTGATACTATCAACCAAA Merck Cat#TRCN000107267 (Continued on next page) 18 iScience 27, 111133, November 15, 2024 .. shRNA targeting sequence bTrCP#1; GCACATAAACTCGTATCTTAA Merck Cat#TRCN0000006542 shRNA targeting sequence bTrCP#2; GCGTTGTATTCGATTTGATAA Merck Cat#TRCN0000006543 EGFR Taqman assay probe Thermo Scientific Cat#Hs01076078_m1 YAP Taqman assay probe Thermo Scientific Cat#Hs00902712_g1 TAZ Taqman assay probe Thermo Scientific Cat#Hs00210007_m1 Smurf2 Taqman assay probe Thermo Scientific Cat#Hs00224203_m1 MARCH4 Taqman assay probe Thermo Scientific Cat#Hs00863129_m1 DTX3 Taqman assay probe Thermo Scientific Cat#Hs01595350_m1 LONRF3 Taqman assay probe Thermo Scientific Cat#Hs00983071_m1 MID1 Taqman assay probe Thermo Scientific Cat#Hs00931793_m1 TRIM38 Taqman assay probe Thermo Scientific Cat#Hs00197164_m1 TRIM8 Taqman assay probe Thermo Scientific Cat#Hs00229451_m1 TRIM6 Taqman assay probe Thermo Scientific Cat#Hs04194831_s1 Recombinant DNA pLVX-IRES-Neo Takara Cat#632181 HA-AKT1-pLVX-IRES-Neo This paper N/A Flag-AKT2-pLVX-IRES-Neo This paper N/A Flag-TrCP-pLVX-IRES-Neo This paper N/A EGFP-TAZ-pLVX-IRES-Neo This paper N/A mCherry-YAP-pLVX-IRES-Neo This paper N/A Software and algorithms Fiji software Schindelin et al.79 GraphPad Prism software GraphPad Software http://www.graphpad.com Biorender Science Suite Inc. https://www.biorender.com Adobe Illustrator Adobe Inc https://www.adobe.com/ products/illustrator.html

    Sequencing:

    Article Title: Intra-tumoral YAP and TAZ heterogeneity drives collective NSCLC invasion that is targeted by SUMOylation inhibitor TAK-981.
    Article Snippet: Extraction Reagents Thermo Scientific Cat#78833 .. Experimental models: Cell lines Human:H1299-leader cells Commander et al.20 N/A Human:H1299-follower cells Commander et al.20 N/A Human:H1299 Commander et al.20 N/A Human:H460 Adam Marcus, Emory University N/A Human:H23 Adam Marcus, Emory University N/A Human:H1975 Adam Marcus, Emory University N/A Human:H596 Adam Marcus, Emory University N/A Human:PC9 Sun et al.78 N/A Human:A549 ATCC Cat#CCL-185 Human:H293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains NOD scid gamma NSG Jackson Laboratory Cat#006667 Oligonucleotides shRNA targeting sequence TAZ#1; TAAGCTTTATGGGTGTTAATT Merck Cat#TRCN000370006 shRNA targeting sequence TAZ#2; CAGCCAAATCTCGTGATGAAT Merck Cat#TRCN000319150 shRNA targeting sequence YAP#1; CAGGTGATACTATCAACCAAA Merck CatTRCN000107267 shRNA targeting sequence YAP#2; CAGGTGATACTATCAACCAAA Merck Cat#TRCN000107267 (Continued on next page) 18 iScience 27, 111133, November 15, 2024 .. shRNA targeting sequence bTrCP#1; GCACATAAACTCGTATCTTAA Merck Cat#TRCN0000006542 shRNA targeting sequence bTrCP#2; GCGTTGTATTCGATTTGATAA Merck Cat#TRCN0000006543 EGFR Taqman assay probe Thermo Scientific Cat#Hs01076078_m1 YAP Taqman assay probe Thermo Scientific Cat#Hs00902712_g1 TAZ Taqman assay probe Thermo Scientific Cat#Hs00210007_m1 Smurf2 Taqman assay probe Thermo Scientific Cat#Hs00224203_m1 MARCH4 Taqman assay probe Thermo Scientific Cat#Hs00863129_m1 DTX3 Taqman assay probe Thermo Scientific Cat#Hs01595350_m1 LONRF3 Taqman assay probe Thermo Scientific Cat#Hs00983071_m1 MID1 Taqman assay probe Thermo Scientific Cat#Hs00931793_m1 TRIM38 Taqman assay probe Thermo Scientific Cat#Hs00197164_m1 TRIM8 Taqman assay probe Thermo Scientific Cat#Hs00229451_m1 TRIM6 Taqman assay probe Thermo Scientific Cat#Hs04194831_s1 Recombinant DNA pLVX-IRES-Neo Takara Cat#632181 HA-AKT1-pLVX-IRES-Neo This paper N/A Flag-AKT2-pLVX-IRES-Neo This paper N/A Flag-TrCP-pLVX-IRES-Neo This paper N/A EGFP-TAZ-pLVX-IRES-Neo This paper N/A mCherry-YAP-pLVX-IRES-Neo This paper N/A Software and algorithms Fiji software Schindelin et al.79 GraphPad Prism software GraphPad Software http://www.graphpad.com Biorender Science Suite Inc. https://www.biorender.com Adobe Illustrator Adobe Inc https://www.adobe.com/ products/illustrator.html



    Similar Products

    caggtgatactatcaaccaaa merck cat  (Merck & Co)
    86
    Merck & Co caggtgatactatcaaccaaa merck cat
    Caggtgatactatcaaccaaa Merck Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caggtgatactatcaaccaaa+merck+cat/caggtgatactatcaaccaaa+cat+merck+trcn000107267/pm39524367-229-85-86
    Average 86 stars, based on 1 article reviews
    caggtgatactatcaaccaaa merck cat - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results